...gene transfer of soluble VEGF receptor sFlt-1 | Gene Therapy

来自 : 发布时间：2025-03-10

Inhibition of retinal neovascularisation by gene transfer of soluble VEGF receptor sFlt-1 AbstractRetinal angiogenesis is a central feature of the leading causes of blindness. Current treatments for these conditions are of limited efficacy and cause significant adverse effects. In this study, we evaluated the angiostatic effect of gene transfer of the soluble VEGF receptor sFlt-1 in a mouse model of ischaemia-induced retinal neovascularisation using adenovirus and adeno-associated virus (AAV) vectors. We induced proliferative retinopathy in mice by exposure to 75% oxygen from postnatal day 7 (p7) to p12 and injected intravitreally recombinant viral vectors expressing the reporter green fluorescent protein (GFP) or vectors expressing the VEGF inhibitor sFlt-1. Efficient adenovirus-mediated GFP expression was evident in cells of the corneal endothelium and iris pigment epithelium. AAV-mediated GFP expression was evident in ganglion cells and cells of the inner nuclear layer of the retina. Vector-mediated sFlt-1 expression was confirmed by ELISA of pooled homogenised whole eyes. Injection of either vector expressing sFlt-1 resulted in a reduction in the number of neovascular endothelial cells by 56% and 52% for adenovirus and AAV vectors, respectively (P 0.05). Local gene transfer of sFlt-1 consistently inhibits experimental retinal neovascularisation by approximately 50% and offers a powerful novel approach to the clinical management of retinal neovascular disorders. IntroductionAngiogenesis is a complex multistep process that involves outsprouting of vascular endothelial cells from existing vessels. This is critical for embryonic development, growth, endometrial and placental proliferation, wound healing and revascularisation of ischaemic tissues. Angiogenesis is also a central feature of many important diseases including cancer, rheumatoid arthritis, atherosclerosis and ocular neovascularisation. Neovascular diseases of the retina include retinopathy of prematurity, diabetic retinopathy and age-related macular degeneration, conditions which are leading causes of blindness in developed countries.123 Conventional treatments for these disorders are based on laser photocoagulation and cryotherapy, which are themselves inherently destructive, and have significant potential to adversely affect vision.45 Perhaps more importantly, the effects of these therapies are rarely sustained, and they do not control the pro-angiogenic mechanisms arising from the underlying disease. Advances in the understanding of the pathophysiology of angiogenesis have identified disturbances in a multistep process involving complex interactions between growth factors, extracellular matrix, and cellular components, the net outcome being determined by the balance of angiogenic and angiostatic elements.6Vascular endothelial growth factor (VEGF) is a potent endothelial cell-specific mitogen that plays a critical role in angiogenesis.78 VEGF is a 46-kDa homodimeric glycopeptide that is expressed by several different ocular cell types including pigment epithelial cells, pericytes, vascular endothelial cells, neuroglia and ganglion cells,791011 and in specific spatial and temporal patterns during retinal development.12 Expression of VEGF is upregulated by hypoxia in vitro13 and in vivo.10 It acts via specific fms-like receptors, Flt-1 and Flk-1/KDR, which are high-affinity receptor tyrosine kinases expressed on vascular endothelial cells (amongst others14), and leads to endothelial cell proliferation, migration, and increased vasopermeability. VEGF levels are increased in experimental models of retinal ischaemia,915 in patients with proliferative diabetic retinopathy,161718 ROP19 and retinal vein occlusion.17 Injection of VEGF into the eyes of non-human primates produces iris neovascularisation20 and overexpression of VEGF by photoreceptors in transgenic mice causes retinal neovascularization.21 Conversely, antagonists of VEGF inhibit experimental retinal822 and iris23 neovascularisation. A soluble truncated form of the VEGF receptor Flt-1, sFlt-1, is the only known endogenous specific inhibitor of VEGF and has attracted considerable attention for its potential clinical application in the inhibition of angiogenesis.2425262728 sFlt-1, which lacks the membrane-proximal imunoglobulin-like domain, the transmembrane spanning region and the intracellular tyrosine-kinase domain, is generated by alternative splicing. The angiostatic activity of sFlt-1 results from inhibition of VEGF by two mechanisms. It causes both sequestration of VEGF, to which it binds with high affinity, and forms inactive heterodimers with membrane-spanning isoforms of the VEGF receptors Flt-1 and KDR.2429Though potentially efficaceous, systemic administration of inhibitors of angiogenesis may cause adverse effects, particularly in a population of patients, many of whom are already at increased risk of ischaemic heart disease, cerebrovascular and peripheral vascular disease. For this reason, local delivery of angiostatic agents offers significant potential advantages. Repeated intravitreal injections of a neutralizing anti-VEGF monoclonal antibody has been shown to reduce iris neovascularisation in a primate model of retinal ishaemia.23 Inhibition of VEGF by repeated intravitreal injections of recombinant soluble VEGF-receptor (sFlt-1) chimeric proteins25 and antisense oligodeoxynucleotides22 have also been shown to reduce retinal neovascularisation in oxygen-induced retinopathy in mice by an average of 50% and 30%, respectively. However, effective control in patients with retinal neovascular disorders is likely to require the continuous presence of the antagonist. The relatively short half-life of angiostatic proteins delivered by intravitreal injection is such that frequently repeated administration would be necessary to maintain therapeutic levels.30 This approach also carries a high cumulative risk of local complications, including intraocular infection, vitreous haemorrhage and retinal detachment. The implantation of sustained-release devices into the vitreous offers an alternative strategy but is associated with similar adverse effects.31In contrast, local gene transfer offers the possibility of targeted and sustained delivery of therapeutic agents following a single procedure. In this study we show that localised expression of sFlt-1 by gene transfer inhibits retinal neovascularisation in a murine model of ischaemic retinopathy and demonstrate the feasibility of a gene transfer approach to the control of angiogenesis in retinal neovascular disorders.ResultsReporter gene expression by adenovirus and AAV vectorsIn this study we used a well-characterised murine model of ischaemia-induced retinal neovascularisation. In order to determine the pattern of transgene expression following intra-ocular administration of Ad or AAV (serotype 2) vectors in this model, we injected into the vitreous vectors encoding GFP reporter genes driven by a CMV promoter. Previous experiments have indicated that Ad-mediated expression is relatively immediate and transient, whereas AAV-mediated expression is delayed and sustained.32 In order to coordinate the peak of expression of sFlt-1 by each vector with the period of most active angiogenesis in this model (postnatal day (p)12 to p19) we chose to use different injection time-points for each vector system. We injected the Ad vector at p12 because we anticipated expression to be maximal within a few days but rapidly attenuated thereafter, and injected the AAV vector at p2 to compensate for the expected delay in transgene expression. We enucleated and analysed the eyes for vector-mediated expression at p16, 4 days after the onset of ischaemia-induced retinal neovascularisation. In eyes of mice injected with Ad.CMV.GFP, reporter gene expression was evident in cells of the corneal endothelium, iris pigment epithelium and ciliary epithelium (Figure 1b), but not in the retina (except for a very small number of cells in the inner nuclear layer). In eyes of mice injected with AAV.CMV.GFP, expression was evident in retinal cells across a large area of the posterior pole Figure 1d, most prominently in the ganglion cell layer and inner nuclear layer, but also in a small number of photoreceptor cells in the outer nuclear layer. There was no evidence of gene transfer to ciliary epithelial or corneal endothelial cells by AAV of this serotype. No GFP fluorescence was observed in the anterior segment Figure 1aor the retina Figure 1cof uninjected eyes.Figure 1Fluorescence micrographs showing pattern of GFP reporter gene expression after intravitreal injection of Adenovirus and AAV vectors in murine ischaemia-induced retinopathy. Mice were killed at post-natal day (p)16. Enucleated eyes were fixed and 20-渭m cryosections were counterstained with propridium iodide. (a) Anterior segment and (c) retina of control uninjected eyes. No GFP fluorescence is observed. (b) Anterior segment after intravitreal injection of Ad.CMV.GFP at p12. Efficient GFP expression is demonstrated in corneal endothelium (end), trabecular meshwork (tm) iris pigment epithelium (ipe) and ciliary epithelium (ce). GFP expression is not seen in corneal epithelium (ep), corneal stroma (s) or retina (r). (d) Retina after injection of AAV.CMV.GFP at p2. GFP fluorescence is evident primarily in ganglion cell layer (gcl) and inner nuclear layer (inl). GFP positive photoreceptor cells are also present in the outer nuclear layer (onl).Full size imageExpression of sFlt-1 in vivoWe next generated Ad and AAV vectors expressing sFlt-1 under the control of a CMV promoter. The integrity of each expression cassette was verified by transduction of 293T cells in vitro, and Western blotting for sFlt-1. We then injected mice at p12 and p2 for Ad and AAV vectors respectively, as performed for parallel vectors encoding GFP. Eyes were removed at p16, and analysed for expression of sFlt-1 by enzyme-linked immunosorbent assay (ELISA). Concentrations of sFlt-1 were measured in homogenates of pooled whole eyes. In eyes injected with Ad.CMV.sFlt-1 (n = 6), sFlt-1 was detected at a concentration of 72 ng/ml. In eyes injected with AAV.CMV.sFlt-1 (n = 4), sFlt-1 was detected at a concentration of 0.1 ng/ml. sFlt-1 was undetectable in pooled uninjected eyes (n = 6). Attempts to localise sFlt-1 by immunohistochemistry were unsuccessful probably because of technical difficulties localising soluble antigen.Qualitative and quantitative analysis of retinal neovascularisationWe induced ischaemic retinopathy in mouse pups by exposure to high levels of oxygen from p7 to p12. Exposure of mouse pups to hyperoxia in this way causes extensive retinal capillary closure. Subsequent return to room air results in retinal ischaemia and VEGF-dependent pre-retinal neovascularisation in 100% of animals. Assessment of retinal flatmounts following terminal perfusion with dextran-conjugated FITC at p19 indicated fewer neovascular complexes in eyes injected with AAV.CMV.sFlt-1 and Ad.CMV.sFlt-1 than in uninjected eyes or in eyes injected with PBS, Ad.CMV.GFP or AAV.CMV.GFP (Figure 2). We performed quantitative analysis of retinal neovascularisation by counting the number of vascular endothelial cell nuclei on the vitreal side of the inner limiting membrane of the retina in serial sections of eyes at p19. The mean (卤s.e.m.) was 48.2 (4.1) in uninjected eyes (n = 7), 42.1 (5.0) in eyes injected with PBS (n = 7), 34.8 (3.3) in eyes injected with Ad.CMV.GFP (n = 9), 21.4 (4.3) in eyes injected with Ad.CMV.sFlt-1 (n = 7) (P 0.05), 52.1 (6.9) in eyes injected with AAV.CMV.GFP (n = 7), and 23.3 (6.6) in eyes injected with AAV.CMV.sFlt-1 (n = 6) (P 0.05) indicating a significant reduction in neovascularisation following local delivery of a gene encoding sFlt-1 (Figure 3).Figure 2Representatitve FITC-perfused retinal flatmounts at p19. Retinal neovascularisation appears as areas of hyperfluorescence and is indicated (white arrows). (a) Normal age-matched non-ischaemic control. No areas of hyperfluorescence are evident. (b鈥揼) retinas of hyperoxia-exposed mice after different treatment interventions; (b) uninjected, (c) injected with PBS, (d) Ad.CMV.GFP, (e) AAV.CMV.GFP, (f) Ad.CMV.sFlt-1, (g) AAV.CMV.sFlt-1.Full size imageFigure 3Quantification of retinal neovascularisation. The mean number of neovascular cell nuclei at p19 in eyes injected with Ad.CMV.sFlt-1 or AAV.CMV.sFlt-1 was approximately 50% of the number in uninjected eyes (P 0.05) in both cases. Differences between uninjected eyes and eyes injected with PBS or viruses expressing GFP were not statistically significant.Full size imageAssessment of retinal toxicityIn order to determine any potential adverse effects of viral gene transfer of sFlt-1 on normal retinal vascular development or architecture we injected the vectors into the vitreous of normal (non-ischaemic) pups. To assess effects on retinal vasculature we analysed FITC-dextran perfused retinal flatmounts. In the uninjected eye of a normal mouse the vessels form a fine radial branching pattern in the superficial layer and a polygonal reticular pattern in the deep layer (Figure 4a鈥揷). This vascular pattern is preserved after intravitreal injection of Ad.CMV.sFlt-1 at p12 Figure 4e鈥揼or injection of AAV.CMV.sFlt-1 at p2 Figure 4i鈥搆and there is no evidence of altered vascular permeability. To investigate possible adverse effects on retinal architecture, we used light microscopy to examine sections of normal (non-ischaemic) mice injected in the same way Figure 4d, h, l. The retina appeared normal and we observed no evidence of an inflammatory cell infiltrate.Figure 4Determination of potential toxicity resulting from gene transfer of sFlt-1 in normal (non-ischaemic) mice. (a鈥揹) Uninjected controls. (e鈥揾) Injected with Ad.CMV.sFlt-1. (i鈥搇) Injected with AAV.CMV.sFlt-1. (a, e, l) FITC-dextran perfused retinal flatmounts. (b, f, j) Detail of superficial (inner retinal) vascular network at high magnification. (c, g, k) Detail of deep (outer retinal) vascular network at high magnification. The appearance of the retinal vascular networks is similar in all treatment groups. (d, h, l) Light micrographs of H E-stained sections. The retinal architecture appears normal with no evidence of inflammatory cell infiltration or retinal thickening.Full size imageDiscussionAdenovirus-mediated expression of sFlt-1 effectively inhibits tumour growth in mice when the vector is delivered regionally27 or into a remote organ.33 We have shown that local gene transfer and expression of sFlt-1 consistently inhibits experimental retinal neovascularisation by approximately 50% (52% and 56% for AAV and Ad vectors, respectively). At present, it is unclear whether residual neovascularisation is due to incomplete inhibition of the VEGF response, or rather from the uninhibited activity of an alternative angiogenic pathway. The ability of a VEGF receptor kinase inhibitor to completely prevent neovascularisation when delivered systemically in the same model suggests that improved gene delivery and expression might be expected to overcome this limitation.8 It remains to be seen whether efficacy can also be enhanced by gene transfer of dual or multiple antiangiogenic factors. Our findings are consistent with previous studies of VEGF inhibition in which recombinant proteins have been delivered by repeated intravitreal injection. Retinal neovascularisation was reduced by 47% after repeated injection of recombinant sFlt-125 and by 31% after repeated injections of antisense oligodeoxynucleotides.22 Neovascularisation in the murine model of ischaemia-induced retinopathy occurs as a short-lived response; after p21 no further proliferation occurs and the new vessels regress spontaneously.34 Even in this model in which the neovascular response is relatively transient, delivery of sFlt-1 by gene transfer after a single procedure is at least as effective as repeated intravitreal injection. The advantage of a gene transfer approach in facilitating sustained inhibition is likely to be of even greater importance when applied to conditions in which there is a longer-term predilection to neovascularisation. Although AAV-mediated expression of sFlt-1 is likely to be sustained, the long-term effect on neovascularisation cannot be confirmed in this model and will need to be evaluated in further appropriate models and clinical studies.We have evaluated the efficacy of two different viral vector systems with contrasting expression profiles. Although more rapid in onset of expression, most adenoviral vectors are less attractive than AAV vectors for clinical application because of their immunogenicity, toxicity, and short-lived expression.35 The vectors also have contrasting spatial patterns of successful gene transfer and transgene expression. Intravitreal injection of adenoviral vectors results in transduction of the corneal endothelial cells, iris, ciliary body and trabecular meshwork.3637 Transduction of retinal Muller cells has previously been reported after intravitreal injection of adenoviral vectors,383940 but is inefficient unless the injection is combined with a vitrectomy,41 a procedure not performed in our study. We have not demonstrated tissue localisation of sFlt-1 by immunohistochemistry, but can speculate that a substantial proportion of soluble protein secreted by cells in the anterior segment and ciliary body may be directed by aqueous flow anteriorly through the pupil towards the trabecular meshwork. This pattern of expression may be particularly well suited to the delivery of sFlt-1 in the management of neovascularisation of the iris and iridocorneal angle. However, the efficacy of Ad vectors in reducing retinal neovascularisation also suggests that sFlt-1 diffuses posteriorly from the anterior segment across the vitreous body to the inner retina in quantities sufficient to achieve significant VEGF inhibition. In contrast, intravitreal injection of AAV almost exclusively results in reporter gene expression by cells in the retinal ganglion cell layer and inner nuclear layer, consistent with transfection of ganglion cells and Muller cells. The proximity of these cells to the developing neovascular complexes in the retina may explain a comparable angiostatic effect despite relatively low levels of sFlt-1 expression. The localisation of gene expression close to the site of pathology, and the known biological characteristics of gene transfer by AAV vectors makes this a highly attractive strategy for sustained therapy of retinal neovascularisation.VEGF is implicated in retinal vascular development and acts as a survival factor for retinal vascular endothelium in vivo.42 For this reason we investigated the effect of sFlt-1-mediated VEGF inhibition on retinal vascular development and architecture in the normal mouse. The development of the retinal vasculature in mice occurs during the first 2 weeks of life.43 From p0 to p10 vessels develop radially by vasculogenesis from the optic disc to the ora serrata to form a superficial vascular network within the nerve fibre layer of the inner retina. From p4, vessels extend from these superficial vessels by angiogenesis towards the outer retina leading to the formation of a deep vascular plexus. We have demonstrated that the development of both superficial and deep retinal vascular networks is normal despite sFlt-1 expression by either vector system. We also found the retinal architecture to be unaffected. Although we observed no evidence of an inflammatory cell infiltrate in H E-stained histological sections, an immune response to the adenoviral vector is well-described in the literature and is usually only apparent after immunophenotyping.35 Whilst these results suggest that sFlt-1-mediated VEGF inhibition has no dramatic adverse effect on retinal vascular development or structure, there remains the possibility that sustained, complete or uncontrolled inhibiton of VEGF may cause undesirable effects on endothelial cell homeostasis. Incorporation of regulatable expression elements in the vector will minimise these possibilities, and such a strategy is currently being tested.In addition to its central role in angiogenesis,29 VEGF promotes vascular permeability through Flt-1 receptors.44 By reducing vasopermeability, VEGF antagonsits such as sFlt-1 may have additional potential applications in the management of macular oedema, a common cause of visual loss in diabetes,45 uveitis,46 and after cataract surgery.47 In conclusion, gene transfer of sFlt-1 consistently controls angiogenesis in experimental retinal neovascularisation. Our findings demonstrate the feasibility of an in vivo gene therapy approach to the clinical management of angiogenesis in the retina.Materials and methodsrAAV vector construction and productionA recombinant AAV plasmid vector containing the sFlt-1 cDNA driven by a CMV promoter and flanked at the 3鈥?end with a SV40 polyadenylation signal was constructed. The cDNA encoding the sFlt-1 was amplified by PCR from a recombinant adenovirus vector encoding the sFlt-1 DNA (a gift from Dr R Crystal, Cornell University, New York, NY, USA) using the forward primer (TCGGGATCCTCGCCACCATGGTCAGCTACTGGGACACC) which incorporated a BamHI site and a reverse primer (ATAGCGGCCGCTTAATGTTTTACATTACTTTGTGTGGT) which incorporated a NotI site. The PCR was carried out using the proof-reading enzyme Pfu polymerase (Stratagene, Amsterdam, The Netherlands). The 2.1 kb product was digested with BamHI and NotI, then sub-cloned into the mammalian expression cassette pEGFP-N1 (Clontech, Basingstoke, UK) vector by substituting the BamHI鈥?i>NotI EGFP cDNA fragment with the PCR amplified fragment. The sFlt-1 cDNA was verified by sequencing (Lark Technologies, Saffron Walden, UK). The resulting expression cassette was subcloned into a derivative of AAV plasmid psub20148 that was deleted for all viral genes to produce the plasmid AAV.CMV.sFlt-1.Recombinant AAV plasmid expressing GFP driven by the CMV promoter (pHAV 5.5) was produced using the replicating amplicon system described previously,49 with a slight modification in the purification procedure: the CsCl gradient purification step was replaced with an iodoxianol gradient followed by a one-step affinity purification procedure on a Heparin column.50Analysis of sFlt-1 expression by rAAV.CMV.sFlt-1 in vitro293 cells were cultured in six-well culture plates with DMEM (Gibco BRL, Paisley, UK) supplemented with 10% foetal bovine serum. The cells were allowed to grow until they reached approximately 80% confluence at which point they were infected with either rAAV.CMV.sFlt-1 (2 渭l/well, 5 脳 1010 particles) or rAAV-CMV-GFP ((2 渭l/well, 5 脳 1010 particles) as control. After 48 h, the conditioned medium was collected and the proteins greater then 10 kDa were concentrated up using a Centricon YM-10 (Millipore, Bedford, MA, USA). Protein concentrations were determined using a BioRad protein assay (BioRad). Protein samples (50 渭g) were solubilised in SDS-loading buffer and subjected to SDS-polyacrylamide (10%) gel electrophoresis. Protein was transferred on to a nylon membrane (Millipore, Bedford, MA, USA) and the blot was sequentially incubated in primary antibody (1:500 goat anti-sFlt, R D Systems, Abingdon, UK) and secondary antibody horseradish peroxidase-conjugated rabbit antigoat (1/1000 Dako, Carpinteria, CA, USA). The ECL kit (Amersham, Little Chalfont, UK) was used to generate a chemiluminescent signal.Murine model of oxygen-induced retinopathyLitters of C57Bl/6J mice (Harlan, Bicester, UK) were used. All animals were treated in a humane manner and were managed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Murine oxygen-induced retinopathy is a highly reproducible model of VEGF-dependent9 retinal neovascularisation and is described elswhere.34 Briefly, ischaemic retinopathy was induced by exposure of mouse pups to 75 卤 2% oxygen from p7 to p12 in a sealed incubator along with nursing mothers.Intravitreal injectionsMice were anaesthetised with intraperitoneal injection of 0.2 ml Hypnorm (Janssen Pharmaceutical, Oxford, UK), and Hypnovel (Roche, Welwyn Garden City, UK) mixed 1:1:60 with distilled water. The palpebral fissure was opened with a No. 11 scalpel blade and the pupil dilated with topical 1% Tropicamide (1% Mydriacyl; Alcon Laboratories, Watford, UK). The procedure was performed under an operating microscope. The fundus was visualised by means of a contact lens system consisting of a drop of 1% hypromellose solution on the cornea, covered with a glass coverslip. The tip of a 10-mm 34-guage steel needle, mounted on a 10-渭l Hamilton syringe, was advanced under direct vision through the sclera, 1mm posterior to the corneoscleral limbus, into the vitreous and approximately 1 渭l of viral suspension was injected into the vitreous cavity. Eyes were injected with AAV expressing sFlt-1 (AAV.CMV.sFlt-1) at p2 or adenovirus expressing sFlt-1 (Ad.CMV.sFlt-1) at p12, immediately upon removal from the incubator. Control eyes were uninjected, injected with PBS, AAV expressing green fluorescent protein (AAV.CMV.GFP) or adenovirus expressing green fluorescent protein (Ad.CMV.GFP).Imaging of GFP expressionMice were killed at p16 by cervical dislocation. Eyes were enucleated, fixed in 4% paraformaldehyde for 1 h, cryoprotected in 20% sucrose, embedded in optimal cutting temperature medium and frozen in liquid nitrogen. 20-渭m sections were counterstained with propidium iodide, mounted in fluorescent mounting medium and viewed by fluorescence microscopy.Enzyme linked immunosorbent assayPooled whole eyes of mice killed at p16 were ground manually in 150-渭l assay buffer. The resulting suspension was centrifuged at 4000 r.p.m. for 5 min and the supernatant assayed for total sFlt-1 using a commercial total sFlt-1 Test Kit (RELIATech, Braunschweig, Germany).Fluorescein-dextran perfused fused whole retina mountsAt p19, cardiac perfusion was performed with 1 ml PBS containing 50 mg/ml fluorescein-labelled dextran (2 脳 106 average molecular weight, Sigma, St Louis, MO, USA), clarified by centrifugation for 5 min at 10 000 r.p.m.3451 The eyes were enucleated and fixed in 4% paraformaldehyde for 1 h. The cornea and lens were removed and the retina dissected from the eyecup. The retina was cut radially into four quadrants and flat-mounted in Aquamount under a coverslip for examination by fluorescence microscopy at 脳200/400 magnification.Quantification of retinal neovascularisationEyes were enucleated, fixed in 4% paraformaldehyde, processed through a graded series of alcohols and embedded in paraffin. Seven 6-渭m sagittal sections, each 30 渭m apart, on each side of optic nerve were stained with periodic acid Schiff and haematoxylin. The number of neovascular endothelial cell nuclei on the vitreous side of the inner limiting membrane of the retina in each section was counted at 脳400 magnification using a masked protocol. The mean number of cell nuclei per section per eye was used as a single experimental value. The mean numbers of neovascular cell nuclei in each treatment group were compared. Statistical analysis was performed using ANOVA and Student\'s t test with Bonferroni\'s correction for multiple comparisons. A P-value of 鈮?.05 was considered statistically significant.Retinal toxicityThe vectors expressing sFlt-1 were injected into the vitreous of normal (non-ischaemic) pups. Ad.CMV.sFlt-1 was injected at p12 and AAV.CMV.sFlt-1 at p2. Mice were killed at p19. We performed FITC-dextran perfused flatmounts to investigate vascular development and light microscopy of H E stained 6-渭m sections of paraffin-embedded eyes to analyse retinal architecture, inflammatory cell infiltration and retinal thickening. References1Steinkuller P.G. et al. Childhood blindness J Aapos 1999 3: 26 26CAS聽 Article聽Google Scholar聽 2Rahmani B. et al. The cause-specific prevalence of visual impairment in an urban population. The Baltimore Eye Survey Ophthalmology 1996 103: 1721 1721CAS聽 Article聽Google Scholar聽 3Bressler N.M., Bressler S.B. . Preventative ophthalmology. Age-related macular degeneration Ophthalmology 1995 102: 1206 1206CAS聽 Article聽Google Scholar聽 4Bressler N.M., Bressler S.B. . Preventative ophthalmology. Age-related macular degeneration5Bressler N.M., Bressler S.B. . Preventative ophthalmology. Age-related macular degeneration6Laser photocoagulation of subfoveal recurrent neovascular lesions in age-related macular degeneration. Results of a randomized clinical trial. Macular Photocoagulation Study Group, Arch Ophthalmol 1991; 109: 1232鈥?241 Cell 1996 86: 353 3537Aiello L.P. . Vascular endothelial growth factor and the eye: biochemical mechanisms of action and implications for novel therapies Ophthalmic Res 1997 29: 354 354CAS聽 Article聽Google Scholar聽 8Ozaki H. et al. Blockade of vascular endothelial cell growth factor receptor signaling is sufficient to completely prevent retinal neovascularization Am J Pathol 2000 156: 697 697CAS聽 Article聽Google Scholar聽 9Pierce E.A. et al. Vascular endothelial growth factor/vascular permeability factor expression in a mouse model of retinal neovascularization Proc Natl Acad Sci USA 1995 92: 905 905CAS聽 Article聽Google Scholar聽 10Shima D.T. et al. Cloning and mRNA expression of vascular endothelial growth factor in ischemic retinas of Macaca fascicularis Invest Ophthalmol Vis Sci 1996 37: 1334 1334CAS聽 PubMed聽Google Scholar聽 11Mousa S.A., Lorelli W., Campochiaro P.A. . Role of hypoxia and extracellular matrix-integrin binding in the modulation of angiogenic growth factors secretion by retinal pigmented epithelial cells J Cell Biochem 1999 74: 135 135CAS聽 Article聽Google Scholar聽 12Yi X., Mai L.C., Uyama M., Yew D.T. . Time-course expression of vascular endothelial growth factor as related to the development of the retinochoroidal vasculature in rats Exp Brain Res 1998 118: 155 155CAS聽 Article聽Google Scholar聽 13Shweiki D., Itin A., Soffer D., Keshet E. . Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis Nature 1992 359: 843 843CAS聽 Article聽Google Scholar聽 14Chen Y.S. et al. Localisation of vascular endothelial growth factor and its receptors to cells of vascular and avascular epiretinal membranes Br J Ophthalmol 1997 81: 919 919CAS聽 Article聽Google Scholar聽 15Miller J.W. et al. Vascular endothelial growth factor/vascular permeability factor is temporally and spatially correlated with ocular angiogenesis in a primate model Am J Pathol 1994 145: 574 574CAS聽 PubMed聽 PubMed Central聽Google Scholar聽 16Adamis A.P. et al. Increased vascular endothelial growth factor levels in the vitreous of eyes with proliferative diabetic retinopathy Am J Ophthalmol 1994 118: 445 445CAS聽 Article聽Google Scholar聽 17Aiello L.P. et al. Vascular endothelial growth factor in ocular fluid of patients with diabetic retinopathy and other retinal disorders N Engl J Med 1994 331: 1480 1480CAS聽 Article聽Google Scholar聽 18Boulton M. et al. Intravitreal growth factors in proliferative diabetic retinopathy: correlation with neovascular activity and glycaemic management Br J Ophthalmol 1997 81: 228 228CAS聽 Article聽Google Scholar聽 19Stone J. et al. Roles of vascular endothelial growth factor and astrocyte degeneration in the genesis of retinopathy of prematurity Invest Ophthalmol Vis Sci 1996 37: 290 290CAS聽Google Scholar聽 20Tolentino M.J. et al. Vascular endothelial growth factor is sufficient to produce iris neovascularization and neovascular glaucoma in a nonhuman primate Arch Ophthalmol 1996 114: 964 964CAS聽 Article聽Google Scholar聽 21Okamoto N. et al. Transgenic mice with increased expression of vascular endothelial growth factor in the retina: a new model of intraretinal and subretinal neovascularization Am J Pathol 1997 151: 281 281CAS聽 PubMed聽 PubMed Central聽Google Scholar聽 22Robinson G.S. et al. Oligodeoxynucleotides inhibit retinal neovascularization in a murine model of proliferative retinopathy Proc Natl Acad Sci USA 1996 93: 4851 4851CAS聽 Article聽Google Scholar聽 23Adamis A.P. et al. Inhibition of vascular endothelial growth factor prevents retinal ischemia-associated iris neovascularization in a nonhuman primate Arch Ophthalmol 1996 114: 66 66CAS聽 Article聽Google Scholar聽 24Kendall R.L., Thomas K.A. . Inhibition of vascular endothelial cell growth factor activity by an endogenously encoded soluble receptor Proc Natl Acad Sci USA 1993 90: 10705 10705CAS聽 Article聽Google Scholar聽 25Aiello L.P. et al. Suppression of retinal neovascularization in vivo by inhibition of vascular endothelial growth factor (VEGF) using soluble VEGF-receptor chimeric proteins Proc Natl Acad Sci USA 1995 92: 10457 10457CAS聽 Article聽Google Scholar聽 26Goldman C.K. et al. Paracrine expression of a native soluble vascular endothelial growth factor receptor inhibits tumor growth, metastasis, and mortality rate Proc Natl Acad Sci USA 1998 95: 8795 8795CAS聽 Article聽Google Scholar聽 27Kong H.L. et al. Regional suppression of tumor growth by in vivo transfer of a cDNA encoding a secreted form of the extracellular domain of the flt-1 vascular endothelial growth factor receptor Hum Gene Ther 1998 9: 823 823CAS聽 Article聽Google Scholar聽 28Shiose S. et al. Gene transfer of a soluble receptor of VEGF inhibits the growth of experimental eyelid malignant melanoma Invest Ophthalmol Vis Sci 2000 41: 2395 2395CAS聽Google Scholar聽 29Kendall R.L., Wang G., Thomas K.A. . Identification of a natural soluble form of the vascular endothelial growth factor receptor, FLT-1, and its heterodimerization with KDR Biochem Biophys Res Commun 1996 226: 324 324CAS聽 Article聽Google Scholar聽 30Mordenti J. et al. Comparisons of the intraocular tissue distribution, pharmacokinetics, and safety of 125I-labeled full-length and Fab antibodies in rhesus monkeys following intravitreal administration Toxicol Pathol 1999 27: 536 536CAS聽 Article聽Google Scholar聽 31Guembel H.O. et al. Complications after implantation of intraocular devices in patients with cytomegalovirus retinitis Graefes Arch Clin Exp Ophthalmol 1999 237: 824 824CAS聽 Article聽Google Scholar聽 32Ali R.R. et al. Adeno-associated virus gene transfer to mouse retina Hum Gene Ther 1998 9: 81 81CAS聽 Article聽Google Scholar聽 33Takayama K. et al. Suppression of tumor angiogenesis and growth by gene transfer of a soluble form of vascular endothelial growth factor receptor into a remote organ Cancer Res 2000 60: 2169 2169CAS聽Google Scholar聽 34Smith L.E. et al. Oxygen-induced retinopathy in the mouse Invest Ophthalmol Vis Sci 1994 35: 101 101CAS聽Google Scholar聽 35Reichel M.B. et al. Immune responses limit adenovirally mediated gene expression in the adult mouse eye Gene Therapy 1998 5: 1038 1038CAS聽 Article聽Google Scholar聽 36Hoffman L.M., Maguire A.M., Bennett J. . Cell-mediated immune response and stability of intraocular transgene expression after adenovirus-mediated delivery Invest Ophthalmol Vis Sci 1997 38: 2224 2224CAS聽Google Scholar聽 37Cayouette M., Gravel C. . Adenovirus-mediated gene transfer of ciliary neurotrophic factor can prevent photoreceptor degeneration in the retinal degeneration (rd) mouse Hum Gene Ther 1997 8: 423 423CAS聽 Article聽Google Scholar聽 38Di Polo A. et al. Prolonged delivery of brain-derived neurotrophic factor by adenovirus-infected Muller cells temporarily rescues injured retinal ganglion cells Proc Natl Acad Sci USA 1998 95: 3978 3978CAS聽 Article聽Google Scholar聽 39Sakamoto T. et al. Retinal functional change caused by adenoviral vector-mediated transfection of LacZ gene Hum Gene Ther 1998 9: 789 789CAS聽 Article聽Google Scholar聽 40Fukuhara M., Suzuki A., Fukuda Y., Kosaka J. . Adenovirus vector-mediated gene transfer into rat retinal neurons and Muller cells in vitro and in vivo (published erratum appears in Neurosci Lett 1998; 243: 157) Neurosci Lett 1998 242: 93 93CAS聽 Article聽Google Scholar聽 41Sakamoto T. et al. A vitrectomy improves the transfection efficiency of adenoviral vector-mediated gene transfer to Muller cells Gene Therapy 1998 5: 1088 1088CAS聽 Article聽Google Scholar聽 42Alon T. . Vascular endothelial growth factor acts as a survival factor for newly formed retinal vessels and has implications for retinopathy of prematurity Nat Med 1995 1: 1024 1024CAS聽 Article聽Google Scholar聽 43Connolly S.E., Hores T.A., Smith L.E., D\'Amore P.A. . Characterization of vascular development in the mouse retina Microvasc Res 1988 36: 275 275CAS聽 Article聽Google Scholar聽 44Kolch W., Martiny-Baron G., Kieser A., Marme D. . Regulation of the expression of the VEGF/VPS and its receptors: role in tumor angiogenesis Breast Cancer Res Treat 1995 36: 139 139CAS聽 Article聽Google Scholar聽 45Vitale S. et al. Clinically significant macular edema in type I diabetes. Incidence and risk factors Ophthalmology 1995 102: 1170 1170CAS聽 Article聽Google Scholar聽 46Rothova A., Suttorp-van Schulten M.S., Frits Treffers W., Kijlstra A. . Causes and frequency of blindness in patients with intraocular inflammatory disease Br J Ophthalmol 1996 80: 332 332CAS聽 Article聽Google Scholar聽 47Irvine A.R. et al. Macular edema after cataract extraction Ann Ophthalmol 1971 3: 1234 1234CAS聽 PubMed聽Google Scholar聽 48Xiao X., Xiao W., Li J., Samulski R.J. . A novel 165-base-pair terminal repeat sequence is the sole cis requirement for the adeno-associated virus life cycle J Virol 1997 71: 941 941CAS聽 PubMed聽 PubMed Central聽Google Scholar聽 49Zhang X. et al. High-titer recombinant adeno-associated virus production from replicating amplicons and herpes vectors deleted for glycoprotein H Hum Gene Ther 1999 10: 2527 2527CAS聽 Article聽Google Scholar聽 50Conway J.E. et al. High-titer recombinant adeno-associated virus production utilizing a recombinant herpes simplex virus type I vector expressing AAV-2 Rep and Cap Gene Therapy 1999 6: 986 986CAS聽 Article聽Google Scholar聽 51Tobe T. et al. Evolution of neovascularization in mice with overexpression of vascular endothelial growth factor in photoreceptors Invest Ophthalmol Vis Sci 1998 39: 180 180CAS聽 PubMed聽Google Scholar聽 Download referencesAcknowledgementsWe wish to thank Keith Channon for provision of the Ad.GFP virus and M Feldman for help and advice. JWBB is a Wellcome Trust Research Training Fellow. AJT is a Wellcome Trust Senior Clinical Fellow. This work was also supported by Diabetes UK.Author informationAffiliationsDepartment of Molecular Genetics, Institute of Ophthalmology, University College London, London, UKJWB Bainbridge聽 聽RR AliInstitute of Child Health, University College London, London, UKA Mistry,聽M De Alwis,聽AJ Thrasher聽 聽RR AliKennedy Institute of Rheumatology, Imperial College London, London, UKE PaleologDepartment of Medicine and Therapeutics, University of Glasgow, UKA BakerAuthorsJWB BainbridgeView author publicationsYou can also search for this author in PubMed聽Google ScholarA MistryView author publicationsYou can also search for this author in PubMed聽Google ScholarM De AlwisView author publicationsYou can also search for this author in PubMed聽Google ScholarE PaleologView author publicationsYou can also search for this author in PubMed聽Google ScholarA BakerView author publicationsYou can also search for this author in PubMed聽Google ScholarAJ ThrasherView author publicationsYou can also search for this author in PubMed聽Google ScholarRR AliView author publicationsYou can also search for this author in PubMed聽Google ScholarCorresponding authorCorrespondence to RR Ali.Rights and permissionsReprints and PermissionsAbout this articleCite this articleBainbridge, J., Mistry, A., De Alwis, M. et al. Inhibition of retinal neovascularisation by gene transfer of soluble VEGF receptor sFlt-1. Gene Ther 9, 320鈥?26 (2002). https://doi.org/10.1038/sj.gt.3301680Download citationReceived: 23 July 2001Accepted: 29 November 2001Published: 25 March 2002Issue Date: 01 March 2002DOI: https://doi.org/10.1038/sj.gt.3301680Keywordsretinaneovascularisationvascular endothelial growth factorgene therapy Christopher A. Reid, Emily R. Nettesheim, Thomas B. Connor Daniel M. Lipinski Scientific Reports (2018) M El Sanharawi, E Touchard, R Benard, P Bigey, V Escriou, C Mehanna, M-C Naud, M Berdugo, J-C Jeanny F Behar-Cohen Gene Therapy (2013)